• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    The present invention is a detection method of fasciola spp. In a sample, preferably in the stool of a subject, comprising the extraction of fasciola spp. Of said sample, at least one loop-mediated isothermal amplification reaction, lamp, on said dna in the presence of at least one primer selected from seq id no.:1-4 or a functional variety thereof, or their complementary sequences, and the detection of fasciola spp. Evaluating the result of said lamp reaction. The invention also comprises the oligonucleotides used and their use as primers, in addition to the kit containing them to perform the detection assay. (Machine-translation by Google Translate, not legally binding)
    公开号:ES2568943A1
    申请号:ES201630002
    申请日:2016-01-04
    公开日:2016-05-05
    发明作者:Francisco Antonio ROJO VÁZQUEZ；María MARTÍNEZ VALLADARES
    申请人:Universidad de Leon；
    IPC主号:
    专利说明:

    FASCIOLA SPP. DETECTION PROCEDURE,OLIGONUCLEOTIDES USED AND KIT TECHNICAL SECTOR
    The present invention relates to the detection of Fasciola spp. from fecal samples using the isothermal amplification technique of LAMP type nucleic acids, in the human and veterinary health sector, with an impact on the production of meat and dairy products. BACKGROUND OF THE INVENTION
    The infection caused by the parasite helminth Fasciola spp., Or fasciolosis, causes a very severe liver disease in the health of people and animals. In particular, in ruminants it causes a reduction in the rate of growth and milk production as well as the confiscation of the affected livers. The prevalence of fasciolosis in animals is increasing due to different causes such as progressive anthelmintic resistance and environmental modifications that favor the spread of the parasite. From an economic point of view the disease is very significant.
    In some regions this parasite is also a human pathogen. The disease is also able to be transmitted to people, the biological cycle within the definitive host being the same for ruminants and for man.
    Conventionally, the diagnosis of the disease is confirmed by the observation of parasite eggs in the feces of infected animals. However, this is only possible after 7 weeks post-infection (pi) (Martínez-Pérez, JM et al. “Effect of lipopolysaccharide (LPS) from Ochrobactrum intermedium on sheep experimentally infected with Fasciola hepatica.” Parasitol. Res. 112, 2913-23, 2013). The sensitivity of this method is also estimated at only 30%, which results in a high number of false negatives.
    The detection of DNA by polymerase chain reaction (PCR) has resulted in more specific methods for the detection of Fasciola spp. from samples collected from infected animals. For example Martínez-Pérez in the previous publication diagnosed the infection after 2 weeks p.i. using a nested PCR, and after 3 weeks p.i. thanks to a standard PCR, using in both cases stool samples. In that study the sensitivity of both PCRs was higher than the detection by ELISA. Robles-Pérez also diagnosed F. hepatica infection in positive animals using stool samples after 2 weeks p.i. by a standard PCR amplifying a fragment of the region of the second internal transcribed spacer ITS-2 (Robles-Pérez, D. et al. “The diagnosis of fasciolosis in sheep of sheep by means of a PCR and its application in the detection of anthelmintic resistance in sheep flocks naturally infected. ”Vet. Parasitol. 197, 277-282, 2013).
    An alternative to PCR is the loop-mediated isothermal amplification technique.
    or LAMP ("Loop Mediated Isothermal Amplification"; Notomi, T. et al. "Loop-mediated isothermal amplification of DNA. Nucleic Acids. Res. 28: E63, 2000). The LAMP method uses four primers, two internal and two external, which recognize six regions in the target DNA to achieve extremely high specificity. Auto-cycling reactions result in the accumulation of a large amount of the target DNA, while another reaction in the presence of magnesium pyrophosphate allows rapid visual detection of turbidity or visual fluorescence in the presence of fluorescent intercalating dyes such as SYBR Green I .
    CN 102021246 B discloses the detection of Fasciola hepatica and Fasciola gigantica using LAMP from adult parasites of Fasciola spp., Parasite eggs or cercarias of the parasite. The method described first isolates the parasite's eggs from the animal's feces, which is a long and tedious method; or it recovers eggs from the gallbladder or adult liver parasites from supposedly infected animals, which in both cases involves the sacrifice of the animal. This same technique is also described in the publication of Ai (Ai, L. et al. "Rapid identification and differentiation of Fasciola hepatica and Fasciola gigantica by a loopmediated isothermal amplification (LAMP) assay." Vet. Parasitol. 174, 228-233 , 2010). The present invention has the advantage that it uses stool samples, so that it can perform the identification of Fasciola spp. in animals in which the presence of the infection is not known. In addition, unlike the publication, the invention is capable of diagnosing infection by any species of Fasciola spp., Since the sequence of the primers is common for Fasciola hepatica and Fasciola gigantica.
    Currently this technique has also been described by Skuce et al. (2015) in the communication “DNA-based testing for liver fluke infection in sheep, an evaluation of Loop-mediated Isothermal Amplification” to the “25th International Conference of the World Association for the Advancement of Veterinary Parasitology”. This publication is considered the closest to the technique. Skuce used the LAMP technique from feces of infected sheep and detected the parasite after 3 weeks post-infection. On the other hand, the Skuce trials showed cross reactions with Calicophoron daubneyi. The present invention, however, does not cross-react with the DNA of any other adult helminth of Dicrocoelium dendriticum, Calicophoron daubneyi, Teladorsagia circumcincta, Haemonchus contortus and Trichostrongylus colubriformis, which normally parasitize grazing sheep. In addition, he was able to detect the infection from the first week post infection, which demonstrates greater sensitivity.
    The problem that arises is the obtaining of a method of detection of Fasciola spp. more sensitive than in the teachings of Skuce. The present invention proposes the realization of the LAMP method using the primers identified by the SEQ. ID. NO.:1-4. DESCRIPTION OF THE INVENTION
    The present invention is a method of detecting Fasciola spp. in a biological sample, preferably of a subject's feces, comprising the extraction of Fasciola spp. of said sample, at least one loop-mediated isothermal amplification reaction, LAMP, on said DNA in the presence of at least one primer selected from SEQ ID NO.:1-4 or a functional variety thereof, or its complementary sequences , and the detection of Fasciola spp. evaluating the result of said LAMP reaction.
    Within the scope of the present invention, a "functional variant" of a primer is that fragment or extension or variation of the original sequence of said primer that maintains a similar function, so that it can be used in the process of the invention to obtain The same results.
    Said subject is preferably a ruminant. But the present invention for the detection of infection from faecal samples using the LAMP technique could also be used for the detection of Fasciola spp. in other animal species like man. Therefore, another very preferable aspect of the invention is that said subject is a human.
    5 In a further preferable aspect, said Fasciola spp. It is Fasciola hepatica or Fasciola gigantica.
    In a preferable aspect of the invention, said LAMP reaction is performed in the presence of a colorimetric system, more preferably a specific DNA dye, even
    10 more preferably SYBR Green I, calcein or Hydroxynaphthol Blue.
    In another preferable aspect of the process of the invention, said evaluation comprises comparing said LAMP reaction with at least one control sample.
    Another aspect of the present invention are oligonucleotides identified by SEQ. ID. NO.:1-4, or its complementary sequences. In the present application, the two internal primers are called FIP and BIP, and the two external F3 and B3. The respective sequences are specified in Table 2.
    Table 2:
    Sequence Primers (5’-3 ’)
    F3: SEQ ID NO.:1B3: SEQ ID NO.:2FIP: SEQ ID NO.:3 BIP: SEQ ID NO.:4
    The free text translation of the sequence listing is as follows. "DNA" is translated as "DNA"; "Artificial Sequence" is translated as "Artificial Sequence";
    "First" is translated as "primer"; "Spacing Sequence" translates as "Spacer Sequence."
    A very preferable aspect is the use of said oligonucleotides independently as specific primers for the sequence corresponding to the
    30 region of the second internal transcribed spacer (ITS-2) of the Fasciola spp ribosomal DNA (SEQ ID NO: 5). A more preferable aspect is the use of said oligonucleotides in the detection of Fasciola spp in a LAMP reaction.
    The process of the invention achieves greater sensitivity and specificity than other methods of the art in the detection of Fasciola spp.
    The most preferable aspect of the process of the present invention is a kit comprising at least one of the primers identified by the SEQ. ID. NO.:1-4, or its complementary sequences.
    BRIEF DESCRIPTION OF THE FIGURES Figure 1: Result of isothermal amplification type LAMP. Result of isothermal amplification type LAMP and visualized in 2% agarose gel. Serial dilutions of Fasciola hepatica adult DNA with a range of 1 ng / ml (1) to 10-6 ng / ml (7). M: marker. N: negative.
    Figure 2: Conventional PCR result using primers F3 and B3 with samples of animal feces collected before treatment (1-8) and after treatment (9-16). P: positive, N: negative, M: molecular weight marker. EXAMPLES
    With the intention of showing the present invention in an illustrative way, although in no way limiting, the following examples are provided. Example 1: Stool sampling.
    Feces of seven (7) animals experimentally infected with metacercariae of F. hepatica (Ridgeway Research Ltd. Co., Lydney, United Kingdom) were collected weekly. With each sampling, a mixture of feces from all the animals of the same week was made. 0.5 gr of each weekly mixture was stored at -20 ° C for subsequent DNA extraction.
    On the other hand, stool samples were collected from eight (8) sheep naturally infected with Fasciola hepatica. Infection in these animals was previously confirmed by observing the parasite's eggs under a microscope. From each individual sample, 0.5 g of stool was stored at -20 ° C for subsequent DNA extraction.
    From this group, stool samples were collected after 30 days of administration of an anthelmintic treatment with the drug triclabendazole, as described in Example 7. Example 2: DNA extraction from sheep feces infected by F. hepatica
    Each extraction was made from 0.5 g of feces following the instructions of the manufacturer of the “SpeedTools Tissue DNA Extraction Kit” (Biotools B&M Labs). Once the DNA was extracted, it was precipitated with ethanol according to the following protocol:
    - 1:10 of its volume of 3M sodium acetate (ph = 5.2) and 2 times its volume of 100% cold ethanol were added to the DNA sample. The mixture was left 1 hour at -20 ° C.
    - After that time it was centrifuged in a microcentrifuge at 4 ° C and 12,000 rpm for 15 minutes.
    - The supernatant was discarded and 200 µl of 70% cold ethanol was added to re-centrifuge in a microcentrifuge at 4 ° C at 12,000 rpm for 5 minutes. -The supernatant was discarded and the sample was allowed to evaporate at 37 ° C to
    Remove the remains of ethanol.-The resulting pellet was resuspended with 20 µl of distilled and sterile water.
    The DNA of adult parasites of the Fasciola hepatica, Dicrocoelium dendriticum, Calicophoron daubneyi, Teladorsagia circumcincta, Haemonchus contortus and Trichostrongylus colubriformis helmints was independently extracted.
    Example 3. Design of primers for the detection of Fasciola spp.
    Primers were designed from a conserved region for all Fasciola spp. Species, which was ITS-2. Initially, an alignment of several sequences of F. hepatica and F. gigantica that included this region with the MegAlign software (DNASTAR, Inc.) was performed.
    Table 1: Isolated Access Number Banco de Genes (GenBank)
    Fasciola spp. JF708043.1
    F. hepatica GQ231547.1
    F. hepatica JF708026.1
    F. hepatica JF708036.1 F. hepatica HM746786.1
    F. hepatica AM709622.1
    F. hepatica JF432071.1
    F. gigantic JF432074.1
    F. gigantic JF496714.1
    F. gigantic KF425321.1
    F. gigantic AM850108.1
    F. gigantica HM746788.1
    F. gigantic JN828956.1
    From this alignment a consensus sequence of 568 base pairs was obtained from which the primers were designed for isothermal amplification. Two internal primers (FIP and BIP, SEQ ID NO.:1 and 2 respectively) were designed and
    5 two external primers (F3 and B3, SEQ ID NO.:3 and 4, respectively) with the Primer Explorer V4 program (http://primerexplorer.jp/e/).
    Taking into account the model sequence JF708043.1 (Genbank), the primers of the present invention are the following: F3 (SEQ ID NO.:1) consists of 19 pairs of 10 bases and is the same as the model sequence between positions 630-648; the sequence of B3 (SEQ ID NO.:2) consists of 20 bases and is the same as the reverse complementary sequence between positions 97-116; FIP (SEQ ID NO.:3) consists of a sequence of 41 bases whose first 21 are between positions 226246 of the reverse complementary sequence of JF708043.1 (F1c) and the following 20
    15 bases between positions 260-279 of the template sequence (F2); BIP (SEQ ID NO.:4) consists of a sequence of 38 bases whose first 20 are between positions 734-753 of the template sequence (B1c) and the next 18 bases between positions 134-151 of the reverse complementary sequence of JF708043.1 (B2).
    20 Both FIP and BIP contain two distinct sequences that correspond to the sense and antisense sequences of the white DNA, one for priming in the first stage and the other for self-priming in later stages.
    The internal FIP primer binds to the white DNA and starts the strand synthesis
    25 complementary. The external primer F3, which is a few shorter bases and is in lower concentration than FIP, slowly binds in the white DNA and initiates DNA synthesis by strand displacement. By releasing a complementary chain attached to FIP, it can form a loop, curly or loop wound structure at one end. This single strand of DNA serves as a template for DNA synthesis initiated by BIP and subsequent DNA synthesis by shifting the strand from primer B3 causing the production of a DNA in the form of a double loop, which is quickly converted to a Stem loop form by the synthesis of autoceador DNA. This form then serves as a start for the LAMP cycles, the second stage of the LAMP reaction.
    To initiate the LAMP cycles, FIP joins the DNA horseshoe structure and begins the synthesis by strand displacement, which generates an intermediate separation in the horseshoe DNA structure with an additional inverted copy of the white sequence. at the base and a handle or loop formed at the opposite end through the BIP sequence. Subsequently, DNA synthesis by strand displacement produces a complementary structure to the original horseshoe DNA and a horseshoe DNA repaired with an elongated base twice (up to twice as many copies of the white sequence) and a loop at the end opposite. Both products then serve as a template for a BIP primer in subsequent cycles of the strand displacement reaction, of which a part is called elongation and recycling. Thus, the original LAMP sequence is amplified three times every half cycle. The final products are a mixture of horseshoe DNA with different lengths in its stem and with structures similar to a cauliflower with multiple loops formed by the union between alternative inverted repeats of the white sequence in the same chain.
    The specificity of the primers was verified in silico when aligning with the Blast program. https://blast.ncbi.nlm.nih.gov/Blast.cgi CMD=Web&PAGE_TYPE=BlastHome).
    Example 4: Isothermal amplification of LAMP type nucleic acids for the detection of Fasciola spp.
    To perform the amplification, a mixture was made whose final reaction volume was 25 µl, containing 40 pmol of the FIP and BIP primers, 5 pmol of the F3 and B3 primers, and the following final concentrations: 1.4 mM of each dNTPs, 1M betaine, 8mM MgSO4 and 1x "Isothermal Amplification Buffer" buffer (New England Biolabs, UK); 8U of the Bst 2.0 WarmStart DNA polymerase enzyme (New England Biolabs, UK) and 1 µl of a DNA sample from Example 2 were also included in the same mixture. Incubation of the mixture was performed in a thermal cycler (Bio-Rad) at 63 ° C for 60 min and then at 80 ° for 10 min to end the reaction. To visualize the result, 2 µl of a 1:10 dilution of SYBR Green I 10,000 x dye (Invitrogen, USA) was added to each reaction. This dye is sandwiched in the minor groove of the DNA molecule and only emits fluorescence when bound to double stranded DNA. For a positive result a green fluorescence was observed and in the negative samples the orange coloration of the original dye was maintained. In addition, to confirm the amplification, in some samples the result was checked by 2% agarose gel electrophoresis stained with GelRed and visualized by Image Lab statistical software (Bio-Rad) (Figure 1).
    Example 5: Specificity of isothermal amplification of LAMP type nucleic acids for the detection of Fasciola spp.
    The specificity of the primers was checked with DNA samples from adults of Fasciola hepatica and also from the Dicrocoelium dendriticum, Calicophoron daubneyi, Teladorsagia circumcincta, Haemonchus contortus and Trichostrongylus colubriformis helminths (Fig 2). These adult parasites were collected from the liver, rumen and abomasum of 5 adult sheep slaughtered in a municipal slaughterhouse. The primers of the invention did not show cross reactions with any of the other species.
    Example 6. Sensitivity of isothermal amplification of LAMP type nucleic acids for the detection of Fasciola spp.
    The sensitivity of the primers was demonstrated by using the technique with serial dilutions on the basis of 10 DNA samples of the adult Fasciola hepatica parasite, between 1 ng / µl and 10-6 ng / µl. The results demonstrate that the detection limit of the invention is 10-3 ng / µl.
    In experimentally infected animals, the time frame from which detection was possible was also determined. To do this, stool samples were taken from 7 animals experimentally infected with F. hepatica metacercariae as indicated in Example 1. With the present invention it was possible to detect the infection from the first week after the experimental infection. Example 7. Analysis of feces samples from animals naturally infected by F. hepatica by isothermal amplification of LAMP-like nucleic acids.
    Stool samples processing, DNA extraction and amplification were performed as described in Examples 1, 2 and 4. Stool samples from eight (8) sheep previously diagnosed as positive were analyzed by observing the eggs under a microscope. . Each of the animals was treated with a single dose of triclabenzadol (Fasinex®, 10 mg / kg) and 30 days after treatment the presence of F. hepatica was re-verified following the procedure of the previous Examples (Figure 2). The results according to the method of the invention showed that after treatment two (2) animals continued to be infected by F. hepatica.
    These results were compared with a conventional PCR using external primers F3 and B3. For this, a mixture was made, whose final volume of the reaction was 20 µl, which contained a series of components with the following final concentrations: 1.5 µM buffer supplemented with MgCl2 (Biotools, Spain), 0.2 mM of each dNTPs (Biotools, Spain) and 0.5 µM of each primer; 0.4 µl of Taq polymerase (Biotools, Spain), and 1 µl of DNA from each parasite were also included in the same mixture. The thermal cycler (Bio-Rad) was programmed with the following conditions: 5 min at 95 ° C, followed by 40 cycles each with 30 sg at 95 ° C, 30 sg at 63 ° C, and 30 sg at 72 ° C, and a final extension step of 10 min at 72 ° C. The amplification product was analyzed on a 2% agarose gel stained with GelRed and visualized with Image Lab statistical software (Bio-Rad) (Figure 2). The results showed that according to conventional PCR, only 1 of the 8 samples was positive.
    权利要求:
    Claims (13)
    [1]
    1. Fasciola spp. Detection procedure. in a biological sample, which
    comprises: -extraction of Fasciola spp. DNA. of said sample, - at least one loop-mediated isothermal amplification reaction, LAMP,
    on said DNA in the presence of at least one primer selected from SEQ ID NO.:1-4 or a functional variety thereof, or its complementary sequences, and
    - Fasciola spp. detection evaluating the result of said loop-mediated isothermal amplification reaction.
    [2]
    2. A method according to claim 1, characterized in that said biological sample is a stool sample of a subject.
    [3]
    3. A method according to one of claims 1 or 2, characterized in that said subject is a ruminant.
    [4]
    Four. A method according to one of claims 1 or 2, characterized in that said subject is a human.
    [5]
    5. A method according to any one of claims 1 to 4, characterized in that said Fasciola spp. It is Fasciola hepatica or Fasciola gigantica.
    [6]
    6. A method according to any one of claims 1 to 5, characterized in that said LAMP reaction is carried out in the presence of a colorimetric system.
    [7]
    7. A method according to claim 6, characterized in that said colorimetric system is a specific DNA dye.
    [8]
    8. A method according to claim 7, characterized in that said specific DNA dye is SYBR Green I, calcein or Hydroxynaphthol Blue
    [9]
    9. A method according to any of the preceding claims, characterized in that said evaluation comprises comparing said LAMP reaction with at least one control sample.
    [10]
    10. Oligonucleotide identified by one of the SEQ. ID. NO.:1-4, or its complementary sequences.
    [11]
    eleven. Use of an oligonucleotide identified by one of the SEQ. ID. NO.:1-4 as a specific primer for the sequence corresponding to the region of the second internal transcribed spacer ITS-2 of the ribosomal DNA of the Fasciola spp genome.
    [12]
    12. Use of an oligonucleotide according to claim 11, in the detection of Fasciola spp in a LAMP reaction.
    [13]
    13. Kit for carrying out the method of any one of claims 1 to 9, comprising at least one of the primers identified by SEQ. ID. NO.:1-4,
    or its complementary sequences.
    FIGURES
    Figure 1
    Figure 2
    SEQUENCE LISTING
    <110> UNIVERSITY OF LEÃ “N
    <120> FASCIOLA SPP. DETECTION PROCEDURE,OLIGONUCLEÃ “TIDOS USED AND KIT
    <130> IC 2015-17221
    <160> 5
    <170> BiSSAP 1.3
    <210> 1
    <211> 19
    <212> DNA
    <213> Artificial Sequence
    <220>
    <223> First F3
    <400> 1gctggcgtga tctcctcta19
    <210> 2
    <211> 20
    <212> DNA
    <213> Artificial Sequence
    <220>
    <223> First B3
    <400> 2aacgtgcctg gtatggaatttwenty
    <210> 3
    <211> 41
    <212> DNA
    <213> Artificial Sequence
    <220>
    <223> First FIP
    <400> 3tctgccaaga caagggtgca tgtgaggtgc cagatctatg g41
    <210> 4
    <211> 38
    <212> DNA
    <213> Artificial Sequence
    <220>
    <223> First BIP
    <400> 4gtgcagtggc ggaatcgtgg tgtgccgact aggggatc38
    <210> 5
    <211> 563
    <212> DNA
    <213> Fasciola sp.
    <220>
    <223> Spacing sequence ITS2
    <400> 5tgcacgtacg tcgcccggcg gtgcctatcc cgggttggac tgataacctggtctttgacc 60
    atacgtacaa ctctgaacgg tggatcactc ggctcgtgtg tcgatgaagagcgcagccaa 120
    ctgtgtgaat taatgcaaac tgcatactgc tttgaacatc cacatcttgaacgcatattg 180
    cggccatggg ttagcctgtg gccacgcctg tccgagggtc ggcttataaactatcacgac 240
    gcccaaaaag tcgtggcttg ggttttgcca gctggcgtga tctcctctatgagtaatcat 300
    gtgaggtgcc agatctatgg cgtttcccta atgtatccgg atgcacccttgtcttggcag 360
    aaagccgtgg tgaggtgcag tggcggaatc gtggtttaat aatcgggttggtactcagtt 420
    gtcagtgtgt ttggcgatcc cctagtcggc acacttatga tttctgggataattccatac 480
    caggcacgtt ccgtcactgt cactttgtca ttggtttgat gctgaacttggtcatgtgtc 540
    tgatgctatt tctatagcga cgg563
    2
    类似技术:
    公开号 | 公开日 | 专利标题
    Ballesteros et al.2015|An oral DNA vaccine against infectious haematopoietic necrosis virus | encapsulated in alginate microspheres induces dose-dependent immune responses and significant protection in rainbow trout |
    Soliman et al.2006|Reverse transcription loop-mediated isothermal amplification | for rapid detection of viral hemorrhagic septicaemia virus |
    Krasteva et al.2009|Development of loop-mediated isothermal amplification | as a diagnostic tool of toxoplasmosis
    Jacsó et al.2009|First autochthonous Dirofilaria immitis | infection in a dog in Hungary
    Li et al.2009|An improved reverse transcription loop-mediated isothermal amplification assay for sensitive and specific detection of Newcastle disease virus
    Liu et al.2008|Development and evaluation of a one‐step loop‐mediated isothermal amplification for detection of spring viraemia of carp virus
    Coetzee et al.2013|Transplacental infection in goats experimentally infected with a European strain of bluetongue virus serotype 8
    McGarry et al.2007|PCR-based differentiation of Fasciola species |, using primers based on RAPD-derived sequences
    Gutiérrez-Expósito et al.2016|The role of wild ruminants as reservoirs of Besnoitia besnoiti infection in cattle
    Maan et al.2016|Reverse transcription loop-mediated isothermal amplification assays for rapid identification of eastern and western strains of bluetongue virus in India
    Nataraju et al.2009|A study on the possibility of zoonotic infection in rotaviral diarrhoea among calves and buffalo calves in and around Kolkata, India
    Müller et al.2007|Sensitive and species-specific detection of Clonorchis sinensis by PCR in infected snails and fishes
    ES2568943B1|2017-02-15|Fasciola spp. Detection procedure, oligonucleotides used and kit
    ES2736399T3|2019-12-30|Procedure for detection and / or identification of protozoa of the genus Babesia, a primer for use in this procedure and a kit for use in diagnostic procedures for symptomatic and asymptomatic babesiosis
    El‐Matbouli et al.2005|Development of a rapid assay for the diagnosis of Myxobolus cerebralis in fish and oligochaetes using loop‐mediated isothermal amplification
    Plesker et al.2009|A case of an Echinococcus ortleppi infestation in a red-shanked douc langur | in northern Vietnam
    WO2017118989A1|2017-07-13|Orthomyxo-like virus of tilapia
    ES2370432B1|2012-10-22|PROCEDURE, SET OF PRIMERS AND KIT FOR DETECTION OF INFECTIOUS PANCREATIC NECROSIS VIRUS | IN ASYMPTOMATIC FISH.
    KR101081602B1|2011-11-09|Primer sets for detection of Cryptosporidium and a composition comprising the same
    ES2578367B2|2016-12-01|PROCEDURE FOR THE DETECTION, QUANTIFICATION AND / OR IDENTIFICATION OF AEROMONAS SALMONICIDA SPP. SALMONICIDE
    Sharma et al.2012|Sensitivity assay of polymerase chain reaction for detection of Canine Parvo Virus infection in dogs
    KR20090057514A|2009-06-08|Method of diagnostic test for heartworm infection using antigen from wolbachia surface protein
    Pichler et al.2017|A novel snapback primer probe assay for the detection and discrimination of sympatric Haemonchus species using DNA melting analysis
    Aoki2016|Fish Diseases
    JP2013516983A|2013-05-16|Means and method for distinguishing between FECV and FIPV
    同族专利:
    公开号 | 公开日
    ES2568943B1|2017-02-15|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    法律状态:
    2017-02-15| FG2A| Definitive protection|Ref document number: 2568943 Country of ref document: ES Kind code of ref document: B1 Effective date: 20170215 |
    优先权:
    申请号 | 申请日 | 专利标题
    ES201630002A|ES2568943B1|2016-01-04|2016-01-04|Fasciola spp. Detection procedure, oligonucleotides used and kit|ES201630002A| ES2568943B1|2016-01-04|2016-01-04|Fasciola spp. Detection procedure, oligonucleotides used and kit|
    [返回顶部]